Amplification primer kit, a method for detecting a sexually transmitted bacterial infection, and a kit for detecting the infection

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Jan. 5, 2024, is named 18549736_ST25. txt and is 3,216 bytes in size.

Neisseria gonorrhoeae Neisseria gonorrhoeae Neisseria gonorrhoeae The invention relates to a set of primers for detecting(NG) bacteria, a method for detectingusing the set of primers, and the use of the set of primers for detecting. The invention is applicable in medical diagnostics.

Neisseria gonorrhoeae Neisseria gonorrhoeae is a gram-negative bacterium. It is classified as a sexually transmitted disease (STD) pathogen. Also, newborns may become infected during childbirth. The infections mainly affect the urethra, but also the cervical canal, rectum, pharynx and conjunctiva. In Europe, infections with thebacterium are the second most common sexually transmitted infections, after chlamydial infections.

Neisseria gonorrhoeae Neisseria gonorrhoeae Neisseria gonorrhoeae Laboratory diagnosis ofbacteria is based primarily on detecting bacteria in the secretions from the genitourinary tract or swabs collected from body parts that are possible to be infected. Possible methods of detectingbacteria are culture, microscopic methods after staining (Gram or methylene blue) or genetic tests, including the most commonly used Real-Time PCR. Post-staining microscopic tests are characterized by a relatively low sensitivity, especially in the case of asymptomatic infection (<55%), and in the case of rectal infections, even <40%. On the other hand, the culture tests, despite their high sensitivity and specificity, are labour-intensive and time-consuming tests. In addition, the cultures ofrequire specific, selective media.

Neisseria gonorrhoae The methods characterized by the greatest specificity and sensitivity are those involving the detection ofnucleic acid in biological material (the so-called NAAT methods—Nucleic Acid Amplification Tests), i.e., in the urine or urethral swab in men and vaginal or urethral swab in women, moreover in throat or mucosa swabs. The most commonly used tests in NAAT technology are Real-Time PCR-based assays. Many different tests using the Real-Time PCR technique are available on the market, but despite the fierce competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive devices, and the isolation of genetic material from the patient's sample is necessary. Moreover, since cyclic heating and cooling of the reagents is necessary, this method is long, and the devices used consume relatively large amounts of energy to carry out this process.

Isothermal methods, including the LAMP (Loop-mediated isothermal amplification) method, are methods that allow to accelerate the diagnostic process and reduce the cost of energy needed to perform the analysis. Moreover, according to the literature data, these methods are characterized by higher sensitivity and specificity than the aforementioned Real-Time PCR technique, they are also much faster. Their isothermal course does not require specialized equipment.

Neisseria gonorrhoeae Due to the low equipment requirements, isothermal methods are an ideal diagnostic solution for primary care units (POCT—point-of-care testing), where the test can be performed in the practice of a general practitioner or specialist doctor (gynaecologist, urologist) at the first contact of a patient with the doctor. This solution allows for a short turn-around-time (in no more than 15 minutes), which allows for selection of a targeted therapy during the very first visit. This is especially important in the case of the so-called progressiveinfection, which can lead to bacteraemia, where prompt diagnosis and early treatment are extremely important. On the other hand, the use of freeze-dried reagents allows the tests to be stored at room temperature, without the need to freeze the diagnostic tests.

Neisseria gonorrhoeae Neisseria gonorrhoeae The use of primers in the LAMP method for the diagnosis ofis known from the patent applications published so far: CN101831488A; CA3008949A1; WO2016023397A1; ES2773313T3; US20190284618A1; U.S. Pat. No. 10,047,404B2. The LAMP method is disclosed, for example, in patent specifications WO0028082, WO0224902. The above-mentioned patent applications in most cases do not describe the sensitivity and detection limit of. The detection method in some of the above-mentioned patent applications does not allow for quantitative measurement, and the detection is of the end-point type, using agarose gel electrophoresis or other markers based on the colour change of the reaction mixture upon a positive result of the amplification reaction. Some patent applications are implemented in the Real-Time technology, which enables quantitative measurement, but the detection method is based on molecular probes labelled with fluorescent dyes, which significantly increases the costs of the analysis. Moreover, in the described patent applications, the analysis time and time-to-positive result is about 60 minutes. Besides, most of the kits developed and described above are not applicable in POCT diagnostics, and their main application is in laboratories.

Neisseria gonorrhoeae Therefore, there is still a need to provide a diagnostic method using appropriately refined sets of primers used for the diagnosis ofwith the LAMP method, intended for use in point-of-care testing, which allows the detection of bacteria with a very low detection limit (≥10 copies/reaction) in a short time (≤20 min). Unexpectedly, the above problem was solved by the present invention.

Neisseria gonorrhoeae Neisseria gonorrhoeae a) 5′ ATCTTTGGGGCTTGCGGGTG 3′ (nucleic sequence SEQ ID NO: 3 or its reverse and complementary sequence, linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′ TAAAGCGTGGGATGAACAGG 3′-(nucleic sequence SEQ ID NO: 4 or its reverse and complementary sequence; b) 5′ AAGCACGGGGCAAACGACTA 3′-(nucleic sequence SEQ ID NO: 5 or its reverse and complementary sequence, linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′ CAACTTCGCGTACCGTCAT 3′-(nucleic sequence SEQ ID NO: 6 or its reverse and complementary sequence; c) 5′ TATGAGCCGGAACCGAGT 3′ nucleic sequence SEQ ID NO: 1 or its reverse and complementary sequence, and d) 5′ TCGGGAAAGCCTTGGATTC 3′ nucleic sequence SEQ ID NO: 2 or its reverse and complementary sequence. The first subject of the invention is a set of primers for amplifying the nucleotide sequence of theDNA cytosine methyltransferase (dcm) gene, characterized in that it contains a set of internal primers with the following nucleotide sequences a) and b), as well as a set of external primers containing the following nucleotide sequences c) and d) specific for a selected fragment of theDNA cytosine methyltransferase (dcm) gene:

Neisseria gonorrhoeae In a preferred embodiment of the invention the primer set comprises a set of loop primer sequences comprising nucleic sequences contained in or complementary to thedon gene SEQ ID NO: 7-5′ CCTGAAGCTTGGACGGTAAAAC 3′ and SEQ ID NO: 8: 5′ GCCGGCAAAGAAACACTATATCGG 3′ or sequences reverse and complementary thereof.

Neisseria gonorrhoeae Neisseria gonorrhoeae The second subject of the invention is a method for detectingbacteria, characterized in that a selected region of the nucleotide sequence of thegenome (DNA cytosine methyltransferase gene fragment) is amplified using a primer set as defined in the first subject of the invention, the amplification method being the LAMP method.

In a preferred embodiment, the amplification is carried out with a temperature profile of: 69° C., 40 min.

In a further preferred embodiment of the invention, the end-point reaction is carried out with an additional stage of temperature of 80° C., 5 min.

Neisseria gonorrhoeae The third subject of the invention is a method for detecting an infection caused by thebacterium, characterized in that it comprises the detection method defined in the second subject of the invention.

Neisseria gonorrhoeae The fourth subject of the invention is a kit for the detection of an infection caused by, characterized in that it comprises a set of primers as defined in the first subject of the invention.

In a preferred embodiment of the invention, the infection detection kit comprises 5.0 μl of WARMSTART LAMP Master Mix.

In a further preferred embodiment of the invention, individual amplification primers as defined in the first subject of the invention, the primers having the following concentrations: 0.12 μM F3, 0.12 μM B3, 0.96 μM FIP, 0.96 μM BIP, 0.24 μM LoopF, 0.24 μM LoopB; D-(+)-Trehalose dihydrate-6%; mannitol-1.25%; fluorescent marker interacting with double-stranded DNA-EVAGREEN® ≤1× (BIOTIUM) or FLUORESCENT DYE (NEW ENGLAND BIOLABS®) in the amount of ≤0.5 μl or GREENFLUORESCENT Dye (LUCIGEN) in the amount of ≤1 μl or SYTO-13≤16 μM (THERMOFISHER SCIENTIFIC) or SYTO-82≤16 μM (THERMOFISHER SCIENTIFIC) or another fluorescent dye interacting with double-stranded DNA at a concentration that does not inhibit the amplification reaction.

Neisseria gonorrhoeae Neisseria gonorrhoeae The advantage of the primer sets of the invention for the detection of, as well as the method for detectinginfection and the method of detecting the amplification products is the possibility of using them in medical diagnostics at the point of care (POCT) in the target application with a portable genetic analyzer. Freeze-drying of the reaction mixtures of the invention allows the diagnostic kits to be stored at room temperature without reducing the diagnostic parameters of the tests. In turn, the use of a fluorescent dye to detect the amplification product increases the sensitivity of the method, allows to lower the detection limit (down to 10 genome copies/reaction), as well as it enables the quantitative measurement of bacteria in the test sample.

Neisseria gonorrhoeae Neisseria gonorrhoeae 1. The NG dcmF3 oligonucleotide sequence: 5′ TATGAGCCGGAACCGAGT 3′ (SEQ ID NO: 1) is identical to thedcm gene (5′-3′ strand) which is 3′ end adjacent to the F2 primer. Neisseria gonorrhoeae 2. The NG dcmB3 oligonucleotide sequence: 5′ TCGGGAAAGCCTTGGATTC 3′ (SEQ ID NO: 2) is a complementary fragment of thedcm gene (5′-3′ strand) 161 nucleotides away from the 3′ end of the oligonucleotide 1. Neisseria gonorrhoeae 3. The NG dcmF2 oligonucleotide sequence: 5′ TAAAGCGTGGGATGAACAGG 3′ (SEQ ID NO: 4) is a sequence identical to thedcm gene (5′-3′ strand) immediately adjacent to the 3′ end of the oligonucleotide 1. Neisseria gonorrhoeae 4. The NG dcmB2 oligonucleotide sequence: 5′ CAACTTCGCGTACCGTCAT 3′ (SEQ ID NO: 6) is a complementary fragment of thedcm gene (5′-3′ strand) 139 nucleotides away from the 3′ end of the oligonucleotide 1. Neisseria gonorrhoeae 5. The NG dcmF1c oligonucleotide sequence: 5′ ATCTTTGGGGCTTGCGGGTG 3′ (SEQ ID NO:3) is a complementary fragment of thedcm gene (5′-3′ strand) 58 nucleotides away from the 3′ end of the oligonucleotide 1. Neisseria gonorrhoeae 6. The NG dcmB1c oligonucleotide sequence: 5′ AAGCACGGGGCAAACGACTA 3′ (SEQ ID NO: 5) is a sequence identical to thedcm gene (5′-3′ strand) 82 nucleotides away from the 3′ end of the oligonucleotide 1. 7. The NG dcmLoopF oligonucleotide sequence: 5′ CCTGAAGCTTGGACGGTAAAAC 3′ (SEQ ID NO: 7). 8. The NG dcmLoopB oligonucleotide sequence: 5′ GCCGGCAAAGAAACACTATATCGG 3′ (SEQ ID NO: 8). The sequences of specific oligonucleotides used for the detection of thegenetic material using LAMP technology are presented and characterized below.

The sequences of the F1c and F2 oligonucleotides have preferably been linked by a TTTT bridge and used as FIP. The sequences of the B1c and B2 oligonucleotides have preferably been linked by a TTTT bridge and used as BIP.

Neisseria gonorrhoeae 5.0 μl WARMSTART LAMP 2× Master Mix 0.12 μM F3 0.12 μM B3 0.96 μM FIP 0.96 μM BIP 0.24 μM LoopF 0.24 μM LoopB D-(+)-Trehalose dihydrate-6% Mannitol-1.25% Fluorescent marker interacting with double-stranded DNA-EVAGREEN® ≤1× or FLUORESCENT DYE 50× (NEW ENGLAND BIOLABS®) in the amount of 0.5 μl or GREENFLUORESCENT Dye (LUCIGEN) in the amount of ≤1 μl or SYTO-13≤16 μM or SYTO-82≤16 μM or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction. DNA template ≥10 copies/reaction Method of amplifying thedcm gene using the oligonucleotides characterized in Example 1 with LAMP technology and the following composition of the reaction mixture:

Total reaction volume adjusted to 10 μl with DNase and RNase free water.

Neisseria gonorrhoeae 1) 69° C., 40 min 2) preferably for end-point reactions 80° C., 5 min. Method of amplifying thedcm gene using the oligonucleotides characterized in Example 1 and Example 2 with LAMP technology and the composition of the reaction mixture characterized in Example 3 with the following temperature profile:

Neisseria gonorrhoeae Method of amplification and detection of thedcm gene using the oligonucleotides characterized in Example 1 and Example 2 with LAMP technology and the composition of the reaction mixture characterized in Example 3 with the temperature profile characterized in Example 4 and the detection method described below.

Neisseria gonorrhoeae A fluorescent dye is used, capable of interacting with double-stranded DNA, added to the reaction mixture in an amount of 0.5 μl EVAGREEN® 20×; 0.5 μL or a concentration of ≤1×; ≤16 μM respectively for GREENFLUORESCENT Dye (LUCIGEN); SYTO-13 and SYTO-82 before starting the reaction, real-time and/or end-point measurement. Excitation wavelength in the range similar to the FAM dye-490-500 nm (optimally 494 nm) for EVAGREEN®; FLUORESCENT DYE 50× (NEW ENGLAND BIOLABS®), GREENFLUORESCENT Dye (LUCIGEN); SYTO-13 dyes and 535 nm (optimally 541 nm) for SYTO-82 dye; emission wavelength in the range 509-530 nm (optimally 518 nm) for EVAGREEN®; GREENFLUORESCENT Dye (LUCIGEN); SYTO-13 dyes and 556 nm (optimally 560 nm) for SYTO-82 dye, the method of detection, change recording time starting from 11 minutes from the start of the reaction forand the negative control.

Neisseria gonorrhoeae The method of preparation and freeze-drying of reagents for detecting the amplification and detection of thedcm gene using the oligonucleotides characterized in Example 1 and Example 2 with LAMP technology and the composition of the reaction mixture characterized in Example 3 with the temperature profile characterized in Example 4 and the detection method described in Example 5.

The reaction components were mixed according to the composition described in Example 3, except the template DNA, to a total volume of 10 μl. The mixture was transferred to 0.2 ml tubes and subjected to the freeze-drying process according to the parameters below.

−2 The mixture placed in the test tubes was pre-cooled to −80° C. for 2 hours. Then the freeze-drying process was carried out at the temperature of −80° C. for 3 hours under the pressure of 5mBar.

Neisseria gonorrhoeae 2 FIG. The sensitivity was determined by assaying serial dilutions of theQuantitative DNA (ATCCR 700825DQ™) standard with a minimum amount of 10 copies of bacteria per reaction mixture, where the product amplification was measured in real time—(Real-Time LAMP for serial dilutions).

The time required to detect the emitted fluorescence for individual samples is shown in Table 1.

Neisseria gonorrhoeae The characterized primers allow for the detection ofbacteria by detecting the dcm gene fragment at a minimum number of 10 copies/reaction mixture.

TABLE 1 Time required to detect fluorescence for each dilution of the Neisseria gonorrhoeae Quantitative DNA (ATCC ® 700825DQ ™) standard. Sample Time to exceed the baseline fluorescence [min] NG NTC Undetermined NG 10 copies 18.94 NG 20 copies 17.49 NG 50 copies 15.61 NG 100 copies 14.25

1 FIG. 2 FIG. The superiority of the amplification method and the oligonucleotides described in this specification over the tests based on the Real-Time LAMP technology is due to the much higher sensitivity, which is shown inand the reduction of the analysis time shown in.